Monday, October 26, 2009

Gel Electrophoresis Virtual Lab

You may use your book or the web to answer the following questions as you try to solve the crime.

Solve the case:
On the night of October 25th, witnesses reported an unknown individual breaking and entering into Cross Creek Early College. During the investigation, CSI collected a small sample of blood from a broken window that was used at the entrance point. The sample was taken to the CSI Laboratory to be tested.

First, the Lab must replicate the DNA using PCR because the sample of blood is so small.

1. What does PCR stand for and what does it do?

After replicating the DNA, the lab is now ready to cut into manageable segments. In order to do this, the lab techs insert a rescrition enzyme in the sample.


2. What are restriction enzymes? How do they work?

The lab techs used the restriction enzyme called ECO R1. This restriction enzyme cuts between each guanine and adenine. Show how the DNA sample below would be cut by ECO R1.

3.

ATTTCCATGATTCCAATGGGGCAGTTCCTTATATTACGAAAAAAGTTC

TAAAGGTACTAAGGTTACCCCGTCAAGGATATAATGCTTTTTTCAAG

The collected fragments were then run in a gel electrophoresis. The gel contained a sample of the recovered DNA from the crime scene and the DNA of 4 individuals that had been charged with trespassing 3 nights before the night of the breaking and entering.

Now, you are the lab tech that will run these sample on the gel electophoresis apparatus. Please use the following website, to answer these questions.

Once you done, your teacher has the gel from the lab on her desk.

4. Which individuals' blood matches the sample collected by the CSI?



Homework for tonight (this will help you review for the test):
pg. 315 (3-9)
pg. 337 (4-10)
pg. 363 (9-10)

No comments:

Post a Comment