Purpose: to describe the applications of biotechnology.
First, the lab must replicate the DNA using PCR because the sample of DNA is so small.
1. What does PCR stand for and what does it do?
After replicating the DNA, the lab is now ready to cut into manageable segments. In order to do this, the lab techs insert a restriction enzyme in the sample.
2. What are restriction enzymes? How do they work?
3. The lab techs used the restriction enzyme called ECO R1. This restriction enzyme finds the sequence: GAATTC (& CTTAAG) and cuts between the Guanine (G) and Adenine (A). Cut the DNA strand below:
ATTTTGAATTCAAACACGGACTGAATTCCCATATTGCGA
TAAAACTTAAGTTTGTGCCTGACTTAAGGGTATAACGCT
HINT: use http://www.phschool.com/science/biology_place/labbench/lab6/enzwork.html for help!
The collected fragments were then run using gel electrophoresis. The gel contained a sample of the recovered DNA from the crime scene and the DNA of 4 of the suspects.
Now, you are the lab tech that will run these samples on the gel electrophoresis apparatus.
GEL ELECTROPHORESIS VIRTUAL LAB
http://learn.genetics.utah.edu/content/labs/gel/
Show them the correct answer to 12# to the principal CSI investigator (your instructor) to complete your investigation.
Part 2:
Then you may begin the clone webquest:
Today you will be logging in to this website, to learn about cloning.
No comments:
Post a Comment